49 Infos zu Claudia Boehnisch

1 Aktuelle Nachrichten

— ... Claudia Boehnisch- Reiser Elizabeth Boes Shannon Boyes Julie Brabant Leona Breakall Dell Brown Vanessa Brown Lori Brown- Duncan Stephanie ...

2 Profile in Sozialen Netzwerken

Nicola Cumley Clinical Microbiologist, Queen Elizabeth Hospital ; Elizabeth Marsh Lecturer, University of Derby ; Claudia Boehnisch Regulatory Affairs Manager,

1 Business-Profile

Claudia S Reiser, Claudia Boehnisch-reiser, Reiser Claudia Boehnisch. Full Background Report Sponsored Link. Arrest Records; Court Records; Marriage & Divorce ...

2 Bücher zum Namen

Claudia Boehnisch. * (CB); -kiel.de (HS). Affiliations Institute for Evolution and Biodiversity ...

Claudia Boehnisch. Institute for Biodiversity. 4h-index 5Publications. Research Stats. 4. h-index. 5. Publications Citations. 0. Personal Impact factor.

2 Dokumente

von L Pu — 129 Schulenburg, Hinrich, and Claudia Boehnisch. "Diversification and adaptive sequence evolution of Caenorhabditis lysozymes. (Nematoda: Rhabditidae)." BMC ...

von EK Marsh · — Kindly provided by Claudia Boehnisch. Reverse CCAGTGACTCCACCGCTGTA abl-1. Forward TGCATCAGAGGAGTTTGAGA Primer 3 (v0.4.0). Reverse ATTGTCAGCGTCAGTGCTT fat- ...

3 Wissenschaftliche Publikationen

von J Wang · · Zitiert von: 31 — Acknowledgements. We are grateful to Claudia Boehnisch, Katja Dierking, Martin Hasshoff, Martina Hohloch, Laura Mega, Gregor Schulte, and Daniela Tonn for ...

Their main function appears to be defence against pathogens, ... Authors: Hinrich Schulenburg and Claudia Boehnisch. Citation: BMC Evolutionary Biology

von H Schulenburg · · Zitiert von: 85 — Diversification and adaptive sequence evolution of Caenorhabditislysozymes (Nematoda: Rhabditidae). Hinrich Schulenburg &; Claudia Boehnisch.

5 Allgemeine Veröffentlichungen

... Claudia Boehnisch-Reiser Elizabeth Boes Shannon Boyes Julie Brabant Leona Breakall Dell Brown Vanessa Brown Lori Brown-Duncan Stephanie Burns Marzena ...

Hinrich Schulenburg* and Claudia Boehnisch. Open Access. Address: Department of Animal Evolutionary Ecology, Zoological Institute, University of Tuebingen, ...

von H Schulenburg · · Zitiert von: 77 — Diversification and adaptive sequence evolution of Caenorhabditislysozymes (Nematoda: Rhabditidae). Hinrich Schulenburg &; Claudia Boehnisch. › article

Note from Executive Director In previous articles for this series, I introduced you to members of the NAWCO Certification Committee. This article concludes …

31 Webfunde aus dem Netz

Claudia Boehnisch. 17h05 – 17h30: Ecological consequences of color polymorphism. Anders Forsman. 17h30 – 17h55: Health condition and genetic differentiation ...

... Claudia Boehnisch, Robin May. 280A. Role of autophagy in C. elegans longevity pathways. Sara. Gelino, Louis Lapierre, Binnan Ong, Philip McQuary, Malene.

... Claudia Boehnisch, Ms Claudia B Reiser, Ms Claudia H Reiser, Ms Claudia Boehnisch-reiser are option for Claudia to use. Claudia's residency is at

Claudia Boehnisch, Daniel Wong, Michael Habig, Kerstin Isermann, Nicolaas K. Michiels, Thomas Roeder, Robin C. May, Hinrich Schulenburg. https://doi.org ...

von H Schulenburg · · Zitiert von: 172 — Epub Mar 27. Authors. Hinrich Schulenburg , Claudia Boehnisch, Nico K Michiels. Affiliation. 1 Department of Evolutionary Ecology, Zoological Institute ...

Phenotypic Covariance of Longevity, Immunity and Stress Resistance in the Caenorhabditis Nematodes. FRG Amrit, Claudia Boehnisch, Robin May · Biosciences.

von C Boehnisch · · Zitiert von: 61 — Claudia Boehnisch, Daniel Wong, Michael Habig, Kerstin Isermann, Nicolaas K. Michiels, Thomas Roeder, Robin C. May, Hinrich Schulenburg. Claudia Boehnisch. * ...

... Claudia Boehnisch, Daniel Wong, Michael Habig, Kerstin Isermann, Nicolaas K. Michiels, Thomas Roeder, Robin C. May, Hinrich Schulenburg. Feeding rate (A) and ...

— Claudia Boehnisch · Baum hochzeit · Baum Hochzeit · Leinwand · Deko · Rahmen · Etsy · Hochzeit · Produkte · Hochzeitsdekoration. Folgen ...

WitrynaHinrich Schulenburg* and Claudia Boehnisch Address: Department of Animal Evolutionary Ecology, Zoological Institute, University of Tuebingen, Auf der …

Sieh dir an, was Claudia Boehnisch (claudiaboehnisch) auf Pinterest, der weltweit größten Sammlung von Ideen, entdeckt hat.

Claudia%20Boehnisch: 免费的Z-Library数字图书馆 | BookSC. Download books for free. Find books

Boehnisch, Claudia M. L.: मुफ़्त में डाउनलोड. ई-बुक पुस्तकालय. Z-Library में ऑन लाइन पुस्तकों की दुकान | BookSC. Download books for free. Find books

Claudia%20Boehnisch: مفت ڈاؤنلوڈ. ای بک لائبریری۔ Z-Library پر آن لائن کتابوں کی دکانیں | BookSC. Download books for free. Find books

Claudia%20Boehnisch: मुफ़्त में डाउनलोड. ई-बुक पुस्तकालय. Z-Library में ऑन लाइन पुस्तकों की दुकान | BookSC. Download books for free. Find books

— ... evolution of new immune effector molecules in Caenorhabditis elegans Claudia Boehnisch, Thomas Roeder, Jonathan Ewbank, Nico Michiels, ...

von H Schulenburg · · Zitiert von: 79 — Hinrich Schulenburg* and Claudia Boehnisch. Address: Department of Animal Evolutionary Ecology, Zoological Institute, University of Tuebingen, ...

BMC Evolutionary Biology | download | BookSC. Download books for free. Find books

She is also known as Claudia Reiser, Claudia Boehnisch-Reiser, Claudia S Reiser, Reiser Claudia Boehnisch, Ms Claudia B Reiser, Ms Claudia H Reiser, ...

Hinrich Schulenburg. Claudia Boehnisch. DOI registered June 11, via DataCite. Figure published in figshare Academic Research System.